Needleman-Wunsch Sequence Alignment

Project Image

Project: Needleman-Wunsch Sequence Alignment

Date: 03-22-2009

Implementation Language: Matlab

Description: The Needleman-Wunsch algorithm for global sequence alignment of two genetic sequences.

Files: Needleman-Wunsch Sequence Alignment PDF120.1 KB

Overview:

This project was completed for a Bioinformatics class in which the topic was genetic sequence alignment. The Needleman-Wunsch Sequence Alignment algorithm uses a dynamic programming technique to attempt to align two genetic sequences. Scores are given for different combinations of DNA bases, with lower scores for better combinations. In order to align two sequences, sometimes a gap must be placed in one of the sequences, which results in a worse score. In the experiment, the genetic sequence of one gene which is similar in both humans and mice was compared. Mouse.HEXA=gctgctggaaggggagctggccggtgggccatggccggctgcaggctctgggtttcgctgctgctggcggcggcgttggcttgcttggccacggcactgt Human.HEXA=acgtgattcgccgataagtcacgggggcgccgctcacctgaccagggtctcacgtggccagccccctccgagaggggagaccagcgggccatgacaagct The resulting score was surprisingly 17; Nearly the same.

.